Plant Disease

Lúa mì và lúa mạch là những cây lương thực và làm thức ăn gia súc quan trọng trên khắp thế giới. Lúa mì được trồng trên diện tích lớn hơn bất kỳ cây trồng nào khác trên toàn cầu. Tại Hoa Kỳ, sản xuất lúa mì và lúa mạch đóng góp vào nhu cầu lương thực và thức ăn gia súc trong nước, cũng như góp phần vào thị trường xuất khẩu và cán cân thương mại. Mười lăm năm trước, tạp chí Plant Disease đã xuất bản một bài viết nổi bật mang tiêu đề “Bệnh Thối Đầu Con Gié Lúa Mì và Lúa Mạch: Một căn bệnh tái xuất với tác động tàn phá”. Bài viết đó mô tả loạt các đại dịch bệnh thối đầu con gié (Fusarium head blight - FHB) nghiêm trọng xảy ra tại Hoa Kỳ và Canada, chủ yếu từ năm 1991 đến năm 1996, với nhấn mạnh vào những tác động kinh tế và xã hội chưa từng có gây ra bởi đại dịch bệnh FHB năm 1993 trên các loại hạt mùa xuân tại vùng Northern Great Plains. Các ấn phẩm trước đó đã xử lý phạm vi và thiệt hại do bệnh này tại Hoa Kỳ, Canada, châu Âu và Trung Quốc. Các đánh giá được công bố sau năm 1997 đã mô tả thêm về căn bệnh này và ảnh hưởng của nó đối với sản xuất ngũ cốc ở Bắc Mỹ trong thập niên 1990. Bài báo này đánh giá lại căn bệnh và tài liệu về các đại dịch bệnh FHB ở Hoa Kỳ kể từ năm 1997. Mục tiêu chính của bài báo này là tóm tắt một chương trình nghiên cứu phối hợp và hợp tác bền vững được triển khai ngắn sau đại dịch năm 1993, một chương trình nhằm nhanh chóng đưa đến các chiến lược quản lý cải tiến và triển khai việc tiếp cận cộng đồng. Chương trình này đóng vai trò như một mô hình để xử lý các mối đe dọa bệnh cây trồng mới nổi khác.

In October of 2006, yellow straightneck and zucchini squash plants (Cucurbita pepo L.) with crumpled, curled, thickened leaves were found in St. Johns and Marion counties in central Florida, respectively. Both locations had high populations of the whitefly, Bemisia tabaci. Incidences of symptomatic plants were greater than 95% in three squash fields (33 ha total) in St. Johns County and 35% in an experimental plot in Marion County. Twenty-three samples were collected from symptomatic plants (two from St. Johns County and 21 from Marion County). DNA was extracted for PCR and tested for the presence of begomoviruses using the following pairs of degenerate primers: AC1048/AV494, which amplifies a conserved region of the coat protein gene (2), PAR1c496/PAL1v1978, which amplifies a region of the begomovirus A component, and PBL1v2040/PCRc154, which amplifies a hypervariable region of the begomovirus B component (1). All squash samples yielded amplicons of sizes expected for a bipartite begomovirus: 1,159 nt with PAR1c496/PAL1v1978, 550 nt with AC1048/AV494, and 493 nt with PBL1v2040/PCRc154. The 1,159- and 493-nt amplicons obtained from two squash plants were cloned and sequenced. The 1,159 nt sequences from both plants shared 98% sequence identity with each other and 97% identity with equivalent regions of the A component of Cucurbit leaf crumple virus (CuLCrV) from Arizona and California (GenBank Accession Nos. AF256200 and AF224760, respectively). The 493-nt sequences amplified with PBL1v2040/PCRc154 were identical and shared a 96% identity with CuLCrV sequence (GenBank Accession No. AF327559) from Arizona and 97% identity with CuLCrV B component sequence (GenBank Accession No. AF224761) from California. Leaves were collected from eight symptomatic squash plants from Citra, FL and used for whitefly transmission assays. Approximately 100 adults of Bemisia tabaci biotype B were released onto each caged leaf and given a 24-h acquisition access period, after which a healthy squash seedling was introduced. Symptoms developed within 10 days on all test plants, and the presence of CuLCrV was confirmed by PCR assays, (primer pairs PAR1c496/PAL1v1978 and PBL1v2040/PCRc154) followed by sequencing. In 2007, similar symptoms were seen in several locations around the state. The same assays confirmed the presence of CuLCrV in watermelon (Citrullus lanatus L.) and squash in the following counties: Collier and Hendry in southwest Florida and Hillsborough, Manatee, and Sarasota in west-central Florida. To our knowledge, this is the first report of CuLCrV, and the first report of any begomovirus in cucurbits in Florida.

References: (1) M. R. Rojas et al. Plant Dis. 77:340, 1993. (2) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

During fall 1998, volunteer watermelons (Citrullus lunatus L. (Thunb.) Matsum. & Nakai) showing leaf curl, crumpling, and yellowing symptoms were found in a commercial honeydew melon (Cucumis melo L. subsp. melo Inodorus group) field in the Imperial Valley of California. The plants were infected with a begomovirus (family Geminiviridae, genus Begomovirus) based on (i) a positive response in squash blots probed with a general begomovirus DNA probe (1) and (ii) amplification of DNA-A (≈1.2 kb) and DNA-B (≈1.4 kb) fragments by polymerase chain reaction (PCR) with degenerate DNA-A (PAL1v1978/PAR1c496) and DNA-B (PBL1v2040/PBR1c970) primers, respectively (3). The DNA-A and -B fragments were cloned and sequenced (GenBank accession nos. AF224760 [DNA-A] and AF224761 [DNA-B]). The DNA-A and -B fragments had a nearly identical (99.5%) common region (CR) of 186 (DNA-A) and 187 (DNA-B) nucleotides, indicating they were from the same begomovirus. Database searches conducted with these sequences revealed no high degree of sequence identity (i.e., >90%) with other begomoviruses, including Squash leaf curl virus (SqLCV [2]) from southern California. The partial AC1 sequence (669 nt) was most identical to Tomato severe leaf curl virus (ToSLCV) from Guatemala (83%) and SqLCV (81%), the partial AV1 sequence (135 nt) was most identical to Tomato golden mosaic virus from Brazil (84%) and SqLCV (81%), and the CR was most identical to Squash yellow mottle virus from Costa Rica (81%), ToSLCV (81%), and SqLCV (77%). The partial BV1 sequence (465 nt) was most identical to Bean calico mosaic virus and SqLCV (72%), and the partial BC1 sequence (158 nt) was most identical to SqLCV (75%). Watermelon seedlings bombarded with a DNA extract from infected watermelon volunteers developed crumpling and distortion symptoms, whereas seedlings bombarded with gold particles alone developed no symptoms. Geminivirus infection in symptomatic seedlings was confirmed by PCR. These results suggest a new begomovirus caused the disease symptoms in the watermelon volunteers. Leaf crumpling and curling symptoms were not observed in spring melons in the Imperial Valley in 1999, but on 2 July and 17 August 1999, cantaloupe (C. melo L. subsp. melo Cantalupensis group), muskmelon (C. melo L. subsp. melo Cantalupensis group), and watermelon plants with leaf crumpling and yellowing were found. These plants were infected with the new begomovirus based on sequence analysis of PCR-amplified DNA-A fragments (97 to 98% identity for CR and partial AC1 sequence). A survey of fall melons, conducted 23 to 24 September 1999, revealed widespread symptoms of leaf curl and crumpling on new growth of muskmelon plants in all seven commercial fields examined (estimated incidence 25 to 50%) and on watermelon volunteers. No such symptoms were observed on leaves of honeydew melons. Symptomatic muskmelon and watermelon leaves, collected from eight locations throughout the Imperial Valley, were infected with the new begomovirus based on sequence analysis of PCR-amplified DNA-A fragments. Thus, a new begomovirus has emerged in the Imperial Valley; the name Cucurbit leaf crumple virus (CuLCrV) is proposed.

References: (1) R. L. Gilbertson et al. Plant Dis. 75: 336, 1991. (2) S. G. Lazarowitz and I. B. Lazdins. Virology 180:58, 1991. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993.

In 1998 to 1999, geminivirus-like symptoms were observed in whitefly-infested pumpkin, honeydew melon, and muskmelon in Arizona and Texas and in Coahuilla, Mexico (MX), respectively. Plants exhibited leaf curl and/or mottling, reminiscent of symptoms caused by Squash leaf curl virus (SLCV-WAZ) described from Arizona in 1981 (2). The isolate from Arizona pumpkin fields was experimentally transmitted to pumpkin seedlings by the “B type” of Bemisia tabaci (Genn.), and symptoms were indistinguishable from those observed in infected fields. Samples from AZ, MX, and TX were assessed for begomovirus presence by polymerase chain reaction (PCR) using degenerate primers that amplify a contiguous fragment containing the viral coat protein (Cp) gene and common region (CR) of the A component (CR-A) (~2,100 bp) and a fragment containing the CR of the B component (CR-B) (~1,100 bp). One to four isolates from each location were examined by PCR using both primer pairs, and at least three amplicons per isolate were cloned and their sequences determined. Alignment of viral Cp nucleotide (nt) sequences revealed that AZ [AF256199], MX, and TX field isolates shared 98.7 to 100% sequence identity, but were only 84.5 to 85.6% identical to the Cp gene of SLCV-extended (SLCV-E) [M38183] and SLCV-restricted (SLCV-R) (S. G. Lazarowitz, unpublished), respectively, suggesting a new, previously undescribed begomoviral species (3). Further, the Cp nt sequence of the three field isolates was 6 nt shorter than SLCV-E, SLCV-WAZ [AF256203], and SLCV-R Cp sequences. The CR-A [AF256200] and CR-B [AF256201] sequences (179 nt, each) of field isolates, including the theoretical Rep binding element, GGTGT, were 100% identical. Although the Rep binding site is identical among field isolates, SLCV-E, SLCV-R, and SLCV-WAZ, the field isolate CR sequence shared only 64.2, 67.5, and 66.9% overall identity with CR-A SLCV-E, SLCV-R [M63155], and SLCV-WAZ [AF256202], respectively. Prior to 1998 to 1999, SLCV-WAZ was the only New World begomovirus of cucurbits known to infect both melon (Cucumis) and pumpkin (Cucurbita) (1). Therefore, SLCV was initially suspected as the causal agent. However, here we provide evidence for a new, previously undescribed bipartite begomovirus of cucurbits in AZ, MX, and TX that is herein provisionally designated Cucurbit leaf curl virus (CuLCV). Prediction of its closest begomovirus relatives by Cp nt sequence and Rep binding site comparisons suggest that CuLCV is a new member of the SLCV lineage, also containing Bean calico mosaic virus, Cabbage leaf curl virus, SLCV-E, and Texas pepper virus-TAM.

References: (1) J. K. Brown and M. R. Nelson. Phytopathology 74:1136, 1984. (2) J. K. Brown and M. R. Nelson. Ann. Appl. Biol. 115:243, 1986. (3) M. A. Mayo and C. R. Pringle. J. Gen. Virol. 97:649, 1998.

In August and September 2007, watermelon plants (Citrullus lanatus L.) in commercial fields in Manatee and Hillsborough counties in Florida exhibited stunting, deformation, interveinal chlorosis, and leaf mottling. Adult and immature whiteflies (Bemisia tabaci biotype B) were observed. Leaf samples were collected from seven watermelon and two squash plants showing different combinations of symptoms. Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Valencia, CA) and subjected to reverse transcription (RT)-PCR for the presence of criniviruses using primers specific to regions of the Cucurbit yellow stunting disorder virus (CYSDV) genome encoding the coat protein (CysCP5206F 5′ TTTGGAAAAGAACCTGACGAG 3′; CysCP5600R 5′ TTCATCAACAGATTGGCTGC 3′) and HSP70h genes (2). Total nucleic acids were extracted using Gentra Puregene Kit (Qiagen) and subjected to PCR for the presence of begomoviruses using the degenerate primer pairs AC1048 and AV494, designed to amplify a region of the begomovirus coat protein gene (4), and PBL1v2040 and PCRc154, designed to amplify a region of the hypervariable region of the begomovirus B component (3). RT-PCR amplified the expected 394-bp fragment of the coat protein gene from three symptomatic plants (one squash, two watermelon) and from CYSDV-infected control plants but not from healthy controls. Similarly, the 175-bp HSP70h fragment was amplified from the same samples and from CYSDV-infected control plants but not from healthy controls. The coat protein amplicon was sequenced from one of the Manatee County isolates (GenBank Accession No. EU596528) and the 344 nt sequenced portion of the amplicon was found to be 100% identical to sequences of CYSDV from Texas, California, Jordan, and France (GenBank Accession Nos. AF312823, EU596529, DQ903107, and AY204220, respectively) and shared 99% identity with an isolate from Spain (GenBank Accession No. NC_004810), but only 91% with an isolate from Iran (GenBank Accession No. AY730779). The begomovirus primer pair pBL1v2040 and PCRc154 produced a 678-bp amplicon that is consistent with the presence of a bipartite begomovirus in all nine samples. Sequence analysis of four of the 678-bp amplicons revealed that all had greater than 97% sequence identity to isolates of Cucurbit leaf crumple virus (CuLCrV) from Arizona (GenBank Accession No. AF327559) and California (GenBank Accession No. AF224761). These results are similar to those reported in the first detection of CuLCrV in Florida in 2006 (1). In October 2007, CYSDV was detected in squash plants (Cucurbita pepo L.) in two additional fields in Manatee and Hillsborough counties, and additional fields with CYSDV-like symptoms have been observed with increasing frequency throughout the region. The appearance of CYSDV in Florida follows the recent emergence of CYSDV in California and Arizona and Sonora, Mexico in 2006 where the CYSDV infection of fall melons resulted in severe economic losses (2). The emergence of CYSDV in Florida, where the vector B. tabaci biotype B is well established, warrants concern for all cucurbit production in the southern United States. Disease monitoring efforts are in progress to determine the extent, severity, and impact of CYSDV on Florida cucurbit production.

References: (1) F. Akad et al. Plant Dis.92:648, 2008. (2) Y.-W. Kuo et al. Plant Dis. 91:330, 2007. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Squash vein yellowing virus (SqVYV) is a whitefly-transmitted ipomovirus infecting watermelon and other cucurbits that was recently introduced to Florida. Effects on watermelon are devastating, with total vine collapse, often near harvest, and fruit rendered unmarketable by brown, discolored flesh. The epidemiology of SqVYV was studied in a 1-ha field of ‘Fiesta’ watermelon over six growing seasons (I to VI) to characterize the spatial patterning of disease and temporal rate of disease progress, as well as its association with Cucurbit leaf crumple virus (CuLCrV) and Cucurbit yellow stunting disorder virus (CYSDV), two additional whitefly-transmitted viruses that often occur with SqVYV. The field was scouted at regular intervals for the length of the season for incidence of virus and number of whiteflies. Incidence of SqVYV reached 100% during seasons I, II, and V and 20% during season III. SqVYV did not occur during seasons IV and VI. SqVYV progressed in a characteristic logistic fashion in seasons I, II, and V but less so in season III. The rate of disease progress was similar for the three seasons with high disease incidence, with an average value of 0.18. A positive correlation between the area under the disease progress curve and whitefly-days was found, where both progress curves were calculated as a function of thermal time (degree days, base 0°C). SqVYV displayed significant but variable levels of aggregation, as indicated by its fit to the β-binomial distribution, the binary power law, and ordinary runs analysis. Association analysis indicated that the viruses were largely transmitted independently. Results of this study provide epidemiological information that will be useful in the development of management strategies for SqVYV-induced vine decline, and provide new information for CuLCrV and CYSDV.

In late summer 1999, field- and greenhouse-grown melon plants (Cucumis melo) showing severe stunting and yellowing symptoms were observed near Donna in southern Texas and near the town of Reynosa in northern Mexico. Symptoms were typical of those caused by viruses in the genus Crinivirus, family Closteroviridae. High populations of Bemisia spp. whiteflies were associated with these plantings, with many plants showing heavy infestation. Laboratory analyses showed that melon plants from both locations were infected by the whitefly-transmitted Cucurbit yellow stunting disorder virus (CYSDV). Positive hybridization reactions with digoxigenin-UTP-labeled transcript probes corresponding to the CYSDV heat shock protein 70 (HSP70) homolog coding region (1) were obtained for RNAs extracted from symptomatic plants. Similar probes for the related Lettuce infectious yellows virus (LIYV) and Beet pseudo-yellows virus (BPYV), two whitefly-transmitted viruses previously reported from North America (2), did not hybridize with the RNAs. Definitive confirmation of CYSDV was obtained by performing reverse-transcription polymerase chain reaction (RT-PCR) analyses for two distinct CYSDV coding regions. RT-PCR with primers corresponding to CYSDV, but not LIYV or BPYV HSP70 homolog coding regions, gave specific (≈500 bp) products from corresponding test plants. RNAs from healthy control plants gave no RT-PCR product. Because the HSP70 coding region is highly conserved (2), we also performed RT-PCR with primers designed for the Spanish CYSDV capsid protein gene (GenBank accession AJ243000). Positive RT-PCR products of ≈700 bp were obtained only from the Texas and Mexico melon plants. CYSDV is a widespread and damaging virus of cucurbits in southern Europe and the Middle East (2). This is the first report of this important virus in North America.

References: (1) Tian et al. Phytopathology 86:1167, 1996. (2) Rubio et al. Phytopathology 89:707, 1999.