Telomerase Catalytic Subunit Homologs from Fission Yeast and Human

Greider C. W., Blackburn E. H., Nature 337, 331 (1989).

C. W. Greider K. Collins C. Autexier in DNA Replication in Eukaryotic Cells M. L. DePamphilis Ed. (Cold Spring Harbor Laboratory Press Cold Spring Harbor NY 1996) pp. 619–638.

10.1073/pnas.78.5.3015

McEachern M. J., Blackburn E. H., Nature 376, 403 (1995);

Cooper J. P., Nimmo E. R., Allshire R. C., Cech T. R., ibid. 385, 744 (1997);

10.1126/science.275.5302.986

Zakian V. A., ibid. 270, 1601 (1995).

Harley C. B., Futcher A. B., Greider C. W., Nature 345, 458 (1990);

Hastie N. D., et al., ibid. 346, 866 (1990);

Harley C. B., et al., Cold Spring Harbor Symp. Quant. Biol. 59, 307 (1994).

Counter C. M., et al., EMBO J. 11, 1921 (1992);

Shay J. W., Bacchetti S., Eur. J. Cancer 33, 787 (1997).

10.1126/science.7605428

Feng J., et al., ibid. 269, 1236 (1995).

Collins K., Kobayashi R., Greider C. W., Cell 81, 677 (1995).

10.1126/science.275.5302.973

Nakayama J., Saito M., Nakamura H., Matsuura A., Ishikawa F., Cell 88, 875 (1997).

Lingner J., Cech T. R., Proc. Natl. Acad. Sci. U.S.A. 93, 10712 (1996).

10.1126/science.276.5312.561

Lendvay T. S., Morris D. K., Sah J., Balasubramanian B., Lundblad V., Genetics 144, 1399 (1996).

C. M. Counter M. Meyerson E. N. Eaton R. A. Weinberg Proc. Natl. Acad. Sci. U.S.A. in press.

PCR primers were based on motif B′ (YARACHAARGGHATYCCHYARGG) and motif C (NGTNATDARDARRTARTCRTC) where D = G A or T; H = T A or C; Y = T or C; R = A or G; and N = G A T or C. Approximately 10 6 colonies of an S. pombe Hind III–cut genomic library in pWH5 [

Wright A., Maundrell K., Heyer W. D., Beach D., Nurse P., Plasmid 15, 156 (1986);

] and 10 5 colonies of an S. pombe cDNA library [

Javerzat J.-P., Cranston G., Allshire R. C., Nucleic Acids Res. 24, 4676 (1996);

] were screened.

These cDNA clones terminated in the exon flanked by introns 4 and 5. Poly A + RNA from S. pombe was reverse transcribed using primer M2-B14 (CCTTGGAAAAATCCATTGAAGCCACATGTG). The resulting cDNA was ligated to oligonucleotide pGGGCCGTGTTGGCCTAGTTCTCTGCTCddA using T4 RNA ligase and amplified by two rounds of PCR: in the first round we used primers M2-B14 and Adapt-Sfi (GAGGAGGAGAAGAGCAGAGAACTAGGCCAACACGGCCC) and in the second we used primers M2-B15 (AAAGTGGTATGCCAGAAATCTGAAGGTAAT) and Adapt-Sfi.

Zhang M. Q., Marr T. G., Nucleic Acids Res. 22, 1750 (1994);

. Sequencing of the three original cDNA clones and nine cloned RT-PCR products revealed that two 3′ splice sites were used at similar frequency for splicing of intron 8. These sites were separated by 3 nts giving rise to predicted proteins of 988 and 989 amino acids.

10.1016/0092-8674(93)90234-H

10.1101/gad.10.14.1822

Clone 712562 was obtained from the I.M.A.G.E. (Integrated Molecular Analysis of Genomes and Their Expression) Consortium [

10.1006/geno.1996.0177

]. This clone did not encode a contiguous portion of a TRT because motifs B′ C D and E were contained in a different ORF than the more NH 2 -terminal motifs. In addition the distance between motifs A and B′ was substantially shorter than that of the other three TRTs.

A lambda cDNA library from the human 293 cell line which has high levels of telomerase activity was partitioned into 25 pools containing ∼200 000 plaques each. These were screened by PCR with primers LT5 (CGGAAGAGTGTCTGGAGCAA) and LT6 (GGATGAAGCGGAGTCTGGA) to the 5′ region of the #712562 clone insert. Six subpools of one positive primary pool were further screened by PCR. One positive subpool was then screened by plaque hybridization with a probe from the 5′ region of clone #712562. One phage was positively identified and the ∼4 kbp insert from this clone was excised and subcloned into the pBluescript II SK+ vector (Stratagene) as an Eco RI fragment.

Polyadenylated RNAs from human testis and from the 293 cell line were amplified using a nested PCR strategy. The first primer set was TCP1.1 (GTGAAGGCACTGTTCAGCG) and TCP1.15 (CGCGTGGGTGAGGTGAGGTG); the second primer set was TCP1.14 (CTGTGCTGGGCCTGGACGATA) and bTCP6 (AGCTTGTTCTCCATGTCGCCGTAG).

hTRT mRNA was amplified using oligonucleotide primers LT5 and LT6 (19) for 31 cycles (94°C for 45 s 60°C for 45 s 72°C for 90 s). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA was amplified using primers K136 (CTCAGACACCATGGGGAAGGTGA) and K137 (ATGATCTTGAGGCTGTTGTCATA) for 16 cycles (94°C for 45 s 55°C for 45 s 72°C for 90 s). hTR was amplified using primers F3b (TCTAACCCTAACTGAGAAGGGCGTAG) and R3c (GTTTGCTCTAGAATGAACGGTGGAAG) for 22 cycles (94°C for 45 s 55°C for 45 s 72°C for 90 s). TP1 mRNA was amplified using primers TP1.1 (TCAAGCCAAACCTGAATCTGAG) and TP1.2 (CCCGAGTGAATCTTTCTACGC) for 28 cycles (cycles same as for hTRT). Reaction products were resolved on an 8% polyacrylamide gel stained with SYBR Green I (Molecular Probes Eugene OR).

10.1126/science.1377403

10.1073/pnas.90.13.6320

Patel P. H., et al., Biochemistry 34, 5351 (1995).

Xiong Y., Eickbush T. H., EMBO J. 9, 3353 (1990);

; T. H. Eickbush in The Evolutionary Biology of Viruses S. S. Morse Ed. (Raven New York 1994) pp. 121–157.

Powell M. D., et al., J. Biol. Chem. 272, 13262 (1997).

Ricchetti M., Buc H., Biochemistry 35, 14970 (1996).

Biessmann H., et al., Cell 61, 663 (1990);

Levis R. W., Ganesan R., Houtchens K., Tolar L. A., Sheen F., ibid. 75, 1 (1993);

Pardue M. L., Danilevskaya O. N., Lowenhaupt K., Slot F., Traverse K. L., Trends Genet. 12, 48 (1996).

h + /h − leu1-32/leu1-32 ura4-D18/ura4-D18 ade6-M210/ade6-M216 his3-D1/his3-D1 trt1 + /trt1 − :: his3 + .

C. Alfa P. Fantes J. Hyams M. McLoed E. Warbrick Experiments with Fission Yeast (Cold Spring Harbor Laboratory Press Cold Spring Harbor NY 1993).

Saitou N., Nei M., Mol. Biol. Evol. 4, 406 (1987);

. GenBank protein identification numbers of the sequences used in the phylogenetic analysis can be obtained from the authors. Alignment was analyzed using ClustalW 1.5 [

10.1093/nar/22.22.4673

] and PHYLIP 3.5 [

Felsenstein J., Cladistics 5, 164 (1989)].

We thank R. Adams B. Lastelic L. Tonkin and F. Wu for expert technical assistance; C. Chapon J. P. Cooper R. Gutell E. Jabri and J. Sperger for discussions; R. Allshire and J. A. Wise for plasmids and yeast strains; C. Mattison and the L. Pillus lab for help with microscopy; and A. Sirimarco for manuscript preparation. An S. pombe cDNA library was provided by C. J. Norbury and B. Edgar. Supported by NIH grant GM28039 (T.R.C).