A Natural Product That Lowers Cholesterol As an Antagonist Ligand for FXR
Tóm tắt
Từ khóa
Tài liệu tham khảo
Satyavati G. V., Indian J. Med. Res. 87, 327 (1988).
Nityanand S., Srivastava J. S., Asthana O. P., J. Assoc. Physicians India 37, 323 (1989).
B. Goodwin et al. Mol. Cell 6 517 (2000).
Staudinger J., Liu Y., Madan A., Habeebu S., Klaassen C. D., Drug Metab. Dispos. 29, 1467 (2001).
Single-letter abbreviations for the amino acid residues are as follows: A Ala; C Cys; D Asp; E Glu; F Phe; G Gly; H His; I Ile; K Lys; L Leu; M Met; N Asn; P Pro; Q Gln; R Arg; S Ser; T Thr; V Val; W Trp; and Y Tyr.
Guggulsterones [GS cis - and trans -4 17(20)-pregnadiene-3 16-dione] were obtained from Steraloids (Newport RI) and dissolved in dimethyl sulfoxide (DMSO).
For real-time quantitative PCR reaction mixes included a 200 nM final concentration of a SHP-specific TaqMan probe (5′ ATGTGCCAGGCCTCCGTGCCT) labeled with 6-carboxy fluorescein (FAM) reporter fluorescent dye and a 50 nM and 300 nM final concentration of forward (5′ GTACCTGAAGGGCACGATCC) and reverse (5′ AGCCTCCTGTTGCAGGTGT) primers respectively. For analysis 1 ng of total RNA isolated from primary hepatocytes was used per reaction. The cycle parameters included a reverse transcription step at 48°C for 30 min followed by 40 cycles of 95°C denaturation and 60°C annealing and extension. The 18S rRNA was used for the endogenous control.
For FRET analysis the human FXR ligand-binding domain (LBD) (amino acids 244 to 472) was expressed as a GST-FXR-LBD fusion protein (glutathione S-transferase fused to FXR-LBD) in DH5α and purified using glutathione beads. The FRET assay was performed by incubating 8 nM of GST-FXR-LBD 8 nM of Europium-labeled antibody to GST (Wallac PerkinElmer Life Sciences Boston MA) 16 nM biotin-SRC-1 peptide [5′-biotin-CPSSHSSLTERHKILHRLLQEGSPS-CONH2] (32) 20 nM allophycocyanin conjugated streptavidin (APC-SA) (Wallac) in FRET assay buffer (20 mM KH 2 PO 4 /K 2 HPO 4 (pH 7.3) 150 mM NaCl 2 mM CHAPS detergent 2 mM EDTA 1 mM dithiothreitol (DTT) in the presence of the test compound(s) for 2 to 4 hours at room temperature. Data were collected using an LJL Analyst (Molecular Devices Sunnyvale CA). The results are expressed as 1000*(665 nm/615 nm).
Experimental diets consisted of control diet (TEKLAD 7001 Harlan Teklad Madison WI) supplemented with 2% cholesterol. Male 8- to 12-week-old mice were used for all experiments and were allowed water ad libitum. Z-Guggulsterone was resuspended in 0.2-ml saline and administered to mice by oral gavage. Control animals received the same amount of saline. At the end of the experiment mice fasted for 4 hours after which time livers were harvested and snap-frozen in liquid nitrogen and then stored at –80°C until use.
We thank B. Wagner J. Repa and J. T. Lin for information and helpful suggestions. Supported by grants from the National Institute of Diabetes and Digestive and Kidney Diseases and USDA (to D.D.M.) an NIGMS (National Institute of General Medical Sciences) Initiative for Minority Student Development to Baylor College of Medicine and the Howard Hughes Medical Institute (HHMI) and the Robert A. Welch Foundation (to D.J.M.).