Identification of a Nuclear Receptor for Bile Acids
Tóm tắt
Từ khóa
Tài liệu tham khảo
Seol W., Choi H.-S., Moore D. D., Mol. Endocrinol. 9, 72 (1995).
LaRusso N. F., Hoffman N. E., Hofmann A. F., Northfield T. C., Thistle J. L., Gastroenterology 69, 1301 (1975).
J. J. Repa M. Makishima D. J. Mangelsdorf unpublished material.
Darimont B. D., et al., ibid. 12, 3343 (1998);
; E. M. McInerney et al. ibid. p. 3357.
J. R. Crowther ELISA: Theory and Practice vol. 42 in Methods in Molecular Biology (Humana Totowa NJ 1995).
Wong M. H., Oelkers P., Dawson P. A., ibid. 270, 27228 (1995) ;
Craddock A. L., et al., Am. J. Physiol. 274, G157 (1998).
K. D. Lustig and B. Shan unpublished material.
Gong Y. Z., Everett E. T., Schwartz D. A., Norris J. S., Wilson F. A., Proc. Natl. Acad. Sci. U.S.A. 91, 4741 (1994).
S. D. Turley and J. D. Dietschy in The Liver: Biology and Pathobiology (Raven New York ed. 2 1988) chap. 34
A. F. Hofmann in The Liver: Biology and Pathobiology (Raven New York ed. 3 1994) chap. 38
M. C. Carey and W. C. Duane in The Liver: Biology and Pathobiology (Raven New York ed. 3 1994) chap. 39.
CV-1 cells were cotransfected with a rat FXR expression plasmid a luciferase reporter construct containing five copies of an IR-1 response element and a β-galactosidase (β-Gal) expression vector as a marker as described (4 13). Transfected cells were treated with various compounds (Sigma) for 36 hours and then harvested for luciferase assay. For HepG2 cells cotransfected with human FXR the luciferase reporter plasmid contained three copies of the IR-1 (AGGTCAATGACCT) and cells were treated for 20 hours with compounds before being harvested. Cotransfections with Gal4-receptor chimeras included a luciferase reporter gene (G5-Luc) containing five copies of the Gal4 DNA binding site. Transfection data were normalized to β-Gal are expressed relative to ethanol solvent controls as fold induction or relative light units (RLUs) and represent triplicate assays ± SD.
HEK-293 cells were transfected with plasmids expressing the chimeric proteins Gal4–SRC-1 (amino acids 583 through 783) FXR (amino acids 105 through 472)–VP16 and the G5-Luc reporter. Luciferase activity was measured as in (23).
The FXR LBD (amino acids 105 through 472) was fused to the COOH-terminus of glutathione S-transferase (GST) and the resultant GST-FXR protein was expressed in Escherichia coli and then purified on glutathione beads. For the FRET assay a europium-labeled antibody to GST [anti-GST–(Eu)] (Wallac Gaithersburg MD) was used to tag GST-FXR. SRC-1 (amino acids 595 through 822) was tagged with hexahistidine expressed in E. coli purified by metal ion chromatography biotinylated and labeled with fluorophore allophycocyanin (APC) (Wallac) conjugated to streptavidin. FRET occurs in solution when ligand-mediated changes in the conformation of FXR increase its affinity for SRC-1 resulting in energy transfer from europium (337 nm excitation and 620 nm emission) to APC (620 nm excitation and 665 nm emission). Results are expressed as a ratio of APC to europium fluorescence (665 nm/620 nm). To each well of a black polypropylene 96-well plate was added 10 nM GST-FXR 100 nM biotin–SRC-1 anti-GST–(Eu) (0.2 μg/ml) APC-streptavidin (1 μg/ml) and the indicated compound in 100 μl of buffer [100 mM Hepes (pH 7.6) 0.125% CHAPS and 125 mM NaF]. The reaction was mixed and incubated for 12 hours at 4°C and fluorescence was measured on a Victor II plate reader (Wallac). For ELISA 1.5 μM biotin-labeled peptide (amino acid sequence Ile-Leu-Arg-Lys-Leu-Leu-Gln-Glu) was incubated with 100 nM GST-FXR and the indicated compound in 100 μl of buffer [25 mM tris-HCl (pH 7.4) and 150 mM NaCl] in a 96-well plate for 1 hour. The plate was washed and incubated with rabbit antibody to GST and GST-FXR protein bound to streptavidin was quantitated with a horseradish peroxidase-labeled antibody to rabbit.
CV-1 cells were cotransfected as in Fig. 1 with rat FXR and RXRα expression plasmids and with the indicated luciferase reporter genes. To create the reporter genes the first 1031 bp (pIBABP 1031 -Luc) or 496 bp (pIBABP 496 -Luc) of the mouse I-BABP gene promoter (21) were amplified by polymerase chain reaction (PCR) from mouse genomic DNA and ligated into a Luc reporter plasmid (13). The mutant reporter (pIBABP mut-142 -Luc) was made from the pIBABP 496 -Luc reporter by site-directed mutagenesis within the I-BABP promoter sequence –142 to –130 (Fig. 2A) which converts nucleotides AGGTGAATAACCT to A CC TGAATAA GG T.
Human Cyp7a mRNA was quantitated from HepG2 cells that were treated with the indicated compounds using a TaqMan One Step Gold reverse transcriptase (RT) PCR kit (Applied Biosystems/Perkin Elmer). The Cyp7a primers used were CYP7-78: 5′-TGATTTGGGGGATTGCTATA; CYP7-178: 5′-CATACCTGGGCTGTGCTCT; and CYP7-132(FAM): 5′- (6-FAM) TGGTTCACCCGTTTGCCTTCTCCT (TAMRA). Analysis was performed in triplicate parallel assays.
We gratefully acknowledge the late Kazuhiko Umesono whose pioneering work in the nuclear receptor field inspired much of this work. We thank A. Bronson J. Bembenek T. Lu J. Wu R. Daly and L. Miao for reagents technical support and helpful discussions; D. Russell for the human Cyp7a promoter and critical comments; and C. Weinberger for rat FXR. M.M. and J.J.R. are associates and D.J.M is an investigator of the Howard Hughes Medical Institute. D.J.M. is supported by a grant from the Robert A. Welch Foundation.