Reverse transcription loop-mediated isothermal amplification (RT-LAMP) primer design based on Indonesia SARS-CoV-2 RNA sequence
Tóm tắt
The COVID-19 pandemic has highlighted the importance of tracking cases by using various methods such as the Reverse transcription loop-mediated isothermal amplification (RT-LAMP) which is a fast, simple, inexpensive, and accurate mass tracker. However, there have been no reports about the development of RT-LAMP primer designs that use genome sequences of viruses from Indonesia. Therefore, this study aimed to design an RT-LAMP primer using SARS-CoV-2 genome sequences from Indonesia and several other countries representing five continents in the world, as well as genomes from five Variants of Concern (VOC). The results showed that the consensus sequence of 70 SARS-CoV-2 virus sequences was obtained with a length of 29,982 bases. The phylogenetic test confirmed that the consensus sequence had a close kinship with the SARS-CoV-2 Wuhan Isolate. Furthermore, the SimPlot analysis showed that there was a high genetic diversity of sequences from the Coronaviridae tribal virus at base sequences of 1,500–5,000, 6,500–7,500, and 23,300–25,500. A total of 139 sets of primers were obtained from the primer design with 4 sets namely T1_6, T1_9, T4_7, and T4_52 having the best characteristics. Based on the secondary structure analysis test on 4 sets of primers, T1_6 and T1_9 were predicted not to form secondary structures at RT-LAMP operational temperatures. The primer set T1_9 showed better specificity in BLAST NCBI and eLAMP BLAST tests. This study obtained a primer set of T1_9 with base sequence F3: CACTGAGACTCATTGATGCTATG, B3: CCAACCGTCTCTAAGAAACTCT, F2: GTTCACATCTGATTTGGCTACT, F1c: GAAGTCAACTGAACAACACCACCT, B2: CCTTCCTTAAACTTCTCTTCAAGC, B1c: GTGGCTAACTAACATCTTTGGCACT, LB: TGAAAACAAACCCGCCGTCCTTG, which meets the ideal parameters and has the best specificity. Therefore, it is recommended for use in further tests to recognize SARS-CoV-2 from Indonesia, other five continents, as well as five VOCs, including the new Omicron sub-variant.
Tài liệu tham khảo
Handayani D, Hadi DR, Isbaniah F et al (2020) Penyakit virus corona 2019. J Indones Soc Respirol 40:119–129
Agustina AS, Fajrunni’mah R (2020) Perbandingan metode RT-QPCR dan tes rapid antibodi untuk deteksi COVID-19. Jurnal Kesehatan Manarang 6:47–54
Yanti B, Ismida FD, Sarah KES (2020) Perbedaan uji diagnostik antigen, antibodi, RT-QPCR dan tes cepat molekuler pada Coronavirus Disease 2019. Jurnal Kedokteran Syiah Kuala 20:172–177. https://doi.org/10.24815/jks.v20i3.18719
Khan P, Aufdembrink LM, Engelhart AE (2020) Isothermal SARS-CoV-2 diagnostics: tools for enabling distributed pandemic testing as a means of supporting safe reopenings. ACS Synth Biol 9:2861–2880. https://doi.org/10.1021/acssynbio.0c00359
Damo NY, Porotu’ JP, Rambert GI, Rares FES (2021) Diagnostik coronavirus disease 2019 (COVID-19) dengan pemeriksaan laboratorium mikrobiologi klinik. eBiomedik 9:77–86. https://doi.org/10.35790/ebm.9.1.2021.31899
Yang W, Dang X, Wang Q, et al. (2020) Rapid detection of SARS-CoV-2 using reverse transcription RT-LAMP method. medRxiv 2020.03.02.20030130. https://doi.org/10.1101/2020.03.02.20030130
Lu R, Wu X, Wan Z et al (2020) Development of a novel reverse transcription loop-mediated isothermal amplification method for rapid detection of SARS-CoV-2. Virol Sin 35:344–347. https://doi.org/10.1007/s12250-020-00218-1
Becherer L, Borst N, Bakheit M et al (2020) Loop-mediated isothermal amplification (LAMP)-review and classification of methods for sequence-specific detection. Anal Methods 12:717–746. https://doi.org/10.1039/c9ay02246e
Soroka M, Wasowicz B, Rymaszewska A (2021) Loop-mediated isothermal amplification (LAMP): the better sibling of PCR? Cells 10:1931. https://doi.org/10.3390/cells10081931
Lamb LE, Bartolone SN, Ward E, Chancellor MB (2020) Rapid detection of novel coronavirus/severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) by reverse transcription-loop-mediated isothermal amplification. PLoS ONE 15:e0234692. https://doi.org/10.1371/journal.pone.0234682
Dong Y, Wu X, Li S et al (2021) Comparative evaluation of 19 reverse transcription loop-mediated isothermal amplification assays for detection of SARS-CoV-2. Sci Rep 11:2936. https://doi.org/10.1038/s41598-020-80314-0
Thye AY-K, Law JW-F, Pusparajah P et al (2021) Emerging sars-cov-2 variants of concern (Vocs): an impending global crisis. Biomedicines 9:1303. https://doi.org/10.3390/biomedicines9101303
Mathews DH (2004) Using an RNA secondary structure partition function to determine confidence in base pairs predicted by free energy minimization. RNA 10:1178–1190. https://doi.org/10.1261/rna.7650904
Sternke M, Tripp KW, Barrick D (2020) The use of consensus sequence information to engineer stability and activity in proteins. Methods Enzymol 643:149–179. https://doi.org/10.1016/bs.mie.2020.06.001
Awe OI, Nouhaila E, Nyamari MN, Mukanga LB (2023) Comparative study between molecular and genetic evolutionary analysis tools using African SARS-CoV-2 variants. Inform Med Unlocked 36:101143. https://doi.org/10.1016/j.imu.2022.101143
Mohamed EM, Mousa HM, Keshk AE (2018) Comparative analysis of multiple sequence alignment tools. Int J Inf Technol Comput Sci 10:24–30. https://doi.org/10.5815/ijitcs.2018.08.04
Edgar RC (2004) MUSCLE: a multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics 5:113. https://doi.org/10.1186/1471-2105-5-113
Arbi UY (2016) Analisis kladistik berdasar karakter morfologi untuk studi filogeni: contoh kasus pada Conidae (Gastropoda: Mollusca). Oseana XLI:54–69
Dharmayanti IN (2011) Filogenetika molekuler: metode taksonomi organisme berdasarkan sejarah evolusi. WARTAZOA 21:948–958
Helmy YA, Fawzy M, Elaswad A et al (2020) The COVID-19 pandemic: a comprehensive review of taxonomy, genetics, epidemiology, diagnosis, treatment, and control. J Clin Med 9:1225. https://doi.org/10.3390/jcm9041225
Felsenstein J (2004) Inferring Phylogenies. Sinauer, Sunderland
Tsimpidis M, Bachoumis G, Mimouli K et al (2017) T-RECs: rapid and large-scale detection of recombination events among different evolutionary lineages of viral genomes. BMC Bioinformatics 18:13. https://doi.org/10.1186/s12859-016-1420-z
Lole KS, Bollinger RC, Paranjape RS et al (1999) Full-length human immunodeficiency virus type 1 genomes from subtype C-infected seroconverters in India, with evidence of intersubtype recombination. J Virol 73:152–160
Utama A, Shimizu H (2007) In vitro recombination of poliovirus with Coxsackie A virus serotype 18 at downstream nonstructural protein-coding regions. Microbiol Indones 1:129–134
Li X, Giorgi EE, Marichannegowda H, et al (2020) Emergence of SARS-CoV-2 through recombination and strong purifying selection. Sci Adv 6:eabb9153
Patel JS, Sarma BK (2018) Designing and experimental evaluation of gene-specific primers of pea (Pisum sativum) defense proteins. 3 Biotech 8:482. https://doi.org/10.1007/s13205-018-1508-4
Zhang Y, Tanner NA (2022) Improving RT-LAMP detection of SARS-CoV-2 RNA through primer set selection and combination. PLoS ONE 17:e0254324. https://doi.org/10.1371/journal.pone.0254324
Sasmitha LV, Yustiantara PS, Yowani SC (2018) Desain DNA primer secara in silico sebagai pendeteksi mutasi gen gyrA Mycrobacterium tuberculosis untuk metode polymerase chain reaction. Cakra Kimia (Indonesian E-Journal of Applied Chemistry 6:63–69
Kumar A, Kaur J (2014) Primer based approach for PCR amplification of high GC content gene: mycobacterium gene as a model. Mol Biol Int 2014:1–7. https://doi.org/10.1155/2014/937308
Huang X, Tang G, Ismail N, Wang X (2022) Developing RT-LAMP assays for rapid diagnosis of SARS-CoV-2 in saliva. EBioMedicine 75:103736. https://doi.org/10.1016/j.ebiom.2021.103736
Syamsidi A, Aanisah N, Fiqram R, al Jultri I (2021) Primer design and analysis for detection of mecA gene. Journal of Tropical Pharmacy and Chemistry 5:245–253. https://doi.org/10.25026/jtpc.v5i3.297
Yustinadewi PD, Yustiantara PS, Narayani I (2018) Mdr-1 gene 1199 variant primer design techniques in pediatric patient buffy coat samples with LLA. Jurnal Metamorfosa 5:105–111
Ghosh R, Tarafdar A, Sharma M (2017) Rapid and sensitive diagnoses of dry root rot pathogen of chickpea (Rhizoctonia bataticola (Taub.) Butler) using loop-mediated isothermal amplification assay. Sci Rep 7:42737. https://doi.org/10.1038/srep42737
Noviardi H, Fachrurrazie (2015) Potensi senyawa bullatalisin sebagai inhibitor protein leukotrien A4 hidrolase pada kanker kolon secara in silico. Fitofarmaka 5:65–73
Lee SH, Baek YH, Kim YH et al (2017) One-pot reverse transcriptional loop-mediated isothermal amplification (RT-LAMP) for detecting MERS-CoV. Front Microbiol 7:2166. https://doi.org/10.3389/fmicb.2016.02166
Park GS, Ku K, Baek SH et al (2020) Development of reverse transcription loop-mediated isothermal amplification assays targeting severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). J Mol Diagn 22:729–735. https://doi.org/10.1016/j.jmoldx.2020.03.006
Zhou Y, Wan Z, Yang S et al (2019) A mismatch-tolerant reverse transcription loop-mediated isothermal amplification method and its application on simultaneous detection of all four serotype of dengue viruses. Front Microbiol 10:1056. https://doi.org/10.3389/fmicb.2019.01056
Borah P (2011) Primer designing for PCR. Sci Vis 11:134–136
Montrasio C (2014) Development of a software application for loop-mediated isothermal amplification (LAMP) primer design. University of Milano-Bicocca
Li YC, Lu YC (2019) BLASTP-ACC: parallel architecture and hardware accelerator design for BLAST-based protein sequence alignment. IEEE Trans Biomed Circuits Syst 13:1771–1782. https://doi.org/10.1109/TBCAS.2019.2943539
Ocenar J, Arizala D, Boluk G et al (2019) Development of a robust, field-deployable loop-mediated isothermal amplification (LAMP) assay for specific detection of potato pathogen Dickeya dianthicola targeting a unique genomic region. PLoS ONE 14:e0218868. https://doi.org/10.1371/journal.pone.0218868
Ye J, Coulouris G, Zaretskaya I et al (2012) Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics 13:134–145
Salinas NR, Little DP (2012) Electric LAMP: virtual loop-mediated isothermal amplification. ISRN Bioinform 2012:1–5. https://doi.org/10.5402/2012/696758
Owoicho O, Olwal CO, Tettevi EJ et al (2022) Loop-mediated isothermal amplification for Candida species surveillance in under-resourced setting: a review of evidence. Expert Rev Mol Diagn 22:643–653. https://doi.org/10.1080/14737159.2022.2109963